mtnA

mtnA
168

5-methylthioribose-1-phosphate isomerase

locus
BSU_13550
Molecular weight
38.70 kDa
pI
5
Protein length
Gene length
function
methionine salvage
product
5-methylthioribose-1-phosphate isomerase
essential
no
ec
5.3.1.23
synonyms
mtnA, ykrS, mtnS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0182 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,422,172 1,423,233
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
S-methyl-5-thio--D-ribose 1-phosphate --> 5-methylsulfanyl-D-ribulose 1-phosphate (according to UniProt)
Protein family
eIF-2B alpha/beta/delta subunits family (single member, according to UniProt)
Structure
[PDB|2YVK]
[AF|O31662]
Modification
phosphorylated on Arg-80 and Arg-298 [Pubmed|22517742]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]-[gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]
description
[Pubmed|11545674]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]→[gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]

2024-06-19 05:28:26

Jstuelk

67

5E437FB23A4F009B0E9A667E3F04D466554C0F58

2EB65B4B0A58D80719B6A9288A8B2BEF4BC3FFF2

Biological materials
Mutant
MGNA-B320 (ykrS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1319 NBRP B. subtilis, Japan]
BKE13550 ([gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAATGAATGGGTCATGA, downstream forward: _UP4_TAAAAAACCGCTGGACTTTG
BKK13550 ([gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAATGAATGGGTCATGA, downstream forward: _UP4_TAAAAAACCGCTGGACTTTG
References
11914366,11545674,15102328,12107147,12787499,18039762,22517742,15378759,33782055

32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9

Page visits: 4325

Time of last update: 2024-06-21 19:16:15

Author of last update: Jstuelk