

[metabolite|c-di-AMP]-binding PII-like protein, required for adaptation to osmotic stress

Molecular weight
11.83 kDa
Protein length
Gene length
adaptation to osmotic stress
c-di-AMP-binding PII-like protein
darA, yaaQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3870 (Galperin et al., 2021)

This gene is a member of the following regulons

39,871  40,200
Phenotypes of a mutant
inactivation of [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA] facilitates the adaptation a strain lacking c-di-AMP to growth on complex medium [pubmed|33481774]
the mutant is sensitive to extreme K(+) limitation and to salt stress [pubmed|38832794]
Visit Sartorius.com Visit Sartorius.com
The protein
[PDB|4RLE] (the ''B. subtilis'' protein in complex with c-di-AMP) [Pubmed|25433025]
Effectors of protein activity
binds [metabolite|c-di-AMP] [Pubmed|25433025]
Expression and Regulation
Open in new tab


2024-06-19 03:38:42





expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
Open in new tab


2024-06-17 09:59:41





Open in new tab


2024-06-11 12:15:48





Biological materials
MGNA-B897 (yaaQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1896 NBRP B. subtilis, Japan]
GP1712 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''cat''), available in [wiki|Jörg Stülke]'s lab [Pubmed|25433025]
GP1713 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]''::''cat''), available in [wiki|Jörg Stülke]'s lab
GP2406 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''ermC''), available in [wiki|Jörg Stülke]'s lab
GP2415 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''spc''), available in [wiki|Jörg Stülke]'s lab
GP2497 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA
BKK00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA
Expression vectors
pGP2797: expression of ''darA'' (native RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP3002: expression of ''darA'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP2601: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844], available in [wiki|Jörg Stülke]'s lab [Pubmed|25433025]
pGP1690: IPTG inducible expression, purification in ''E. coli'' with N-terminal cleavable His-tag, in [wiki|pGP570], available in [wiki|Jörg Stülke]'s lab
pGP2624: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP2602: expression of Strep-''darA'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2603: expression of ''darA''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2847: expression of His6-''darA'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
GP2010: expression of ''darA''-Strep in ''B. subtilis'' (chromosomal), suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
available in [wiki|Jörg Stülke]'s lab
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
Original Publications


Page visits: 6328

Time of last update: 2024-06-21 00:39:44

Author of last update: Jstuelk