dnaK

dnaK
168

class I heat-shock protein (molecular chaperone)

locus
BSU_25470
Molecular weight
65.83 kDa
pI
4.57
Protein length
Gene length
function
protein quality control
product
class I heat-shock protein (molecular chaperone)
essential
no
synonyms
dnaK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0443 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,626,112 2,627,947
Phenotypes of a mutant
reduced [wiki|protein secretion] [pubmed|32111210]
a [gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig] [gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK] double mutant exhibits an aberrant twisted and filamentous cell morphology, as well as decreased tolerance to heat and to cell wall active antibiotics and hydrolytic enzymes, indicative of defects in cell wall integrity [pubmed|36726573]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
heat shock protein 70 family (single member, according to UniProt)
Structure
[PDB|2V7Y] (from ''Geobacillus kaustophilus'', 87% identity) [Pubmed|18400763]
[PDB|4ANI] ([protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[protein|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE] complex from ''Geobacillus kaustophilus'', 87% identity) [Pubmed|22544739]
[AF|P17820]
Modification
phosphorylated on Tyr-601 by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ] [Pubmed|27148221,17726680]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
membrane-proximal (Spotty) [Pubmed|16479537]
recruited to the membrane after ethanol stress [Pubmed|22268681]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
description
[Pubmed|9023197]
regulation
induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
regulatory mechanism
[protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]: repression, [Pubmed|1339421], in [regulon|protein:2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1339421], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]→[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]

2024-05-22 01:54:13

ghost

118

5537cbdd2a5f5134768e8ba4f02922d86d6e912b

1FEFD4DF6108A61DA84FEA3CD39009FF4CA3EC3B

Biological materials
Mutant
BKE25470 ([gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAATAACCTCCTGCT, downstream forward: _UP4_TAAGTTCTTTTTAGTGTCAG
BKK25470 ([gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAATAACCTCCTGCT, downstream forward: _UP4_TAAGTTCTTTTTAGTGTCAG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
References
Reviews
35350626
Original Publications
1339421,12224648,10383760,9023197,7540247,7592421,16479537,1339421,17726680,22268681,15378759,22544739,18400763,27148221,32111210,36726573,36815589

30E0AAABB803E577D0D9FBAEF9031319CABD3D89

Page visits: 6643

Time of last update: 2024-05-23 13:21:31

Author of last update: Jstuelk