

pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)

Molecular weight
47.38 kDa
Protein length
Gene length
links glycolysis and TCA cycle
pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508 (Galperin et al., 2021)

This gene is a member of the following regulons

1,530,537 1,531,865
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[protein] + acetyl-CoA --> (R)-N6-(S8-acetyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Lipoyl-binding domain] (aa 2-77) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 141-178) (according to UniProt)
lipoic acid (on Lys-43), can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
[PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus''), [PDB|2PDE] (peripheral subunit binding domain, ''Geobacillus stearothermophilus''), [PDB|1LAC] (lipoyl domain, ''Geobacillus stearothermophilus''), [PDB|1B5S] (catalytic domain (residues 184-425) , ''Geobacillus stearothermophilus'')
phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]
Effectors of protein activity
Inhibited by thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
Low sensibility to NADPH
Kinetic information
Michaelis-Menten [Pubmed|6414463]
Paralogous protein(s)
[protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
membrane associated [Pubmed|18763711]
cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20081037], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-05-22 00:31:42





''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
Open in new tab


2024-05-21 21:54:32





Biological materials
BKE14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
BKK14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
Original Publications


Page visits: 4240

Time of last update: 2024-05-23 02:10:12

Author of last update: Jstuelk