yjdF

yjdF
168

unknown

locus
BSU_12030
Molecular weight
18.68 kDa
pI
10.56
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjdF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,275,809  1,276,291
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|O31647]
Expression and Regulation
Operons
genes
[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
description
[Pubmed|20139185]
regulation
induced by mannose ([protein|F273002AF97D87BB025B4F014C328C5592EAD621|manR]) [Pubmed|20139185]
expession may be controlled by a potential RNA switch located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
regulatory mechanism
[protein|F273002AF97D87BB025B4F014C328C5592EAD621|manR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|protein:F273002AF97D87BB025B4F014C328C5592EAD621|manR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20139185], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]→[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]

2024-07-13 12:06:24

Jstuelk

103

1DACEAC68A02C55C027E015B7DB7FB6ACDDA20C4

1E7704E8FB9878FD0651ED97B4D5E5AC91AB92F5

Biological materials
Mutant
MGNA-A268 (yjdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/268 NBRP B. subtilis, Japan]
BKE12030 ([gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAATCATGCATCCG,  downstream forward: _UP4_TAATCCAAACAAAAGCAGGC
BKK12030 ([gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAATCATGCATCCG,  downstream forward: _UP4_TAATCCAAACAAAAGCAGGC
References
20139185,20230605,29223402,26843526

2DB0F763349D34FB1FCBBB4665416E129AD0AE6A

Page visits: 3644

Time of last update: 2024-07-14 21:01:08

Author of last update: Jstuelk