ribH

ribH
168

riboflavin synthase (beta subunit)

locus
BSU_23250
Molecular weight
16.14 kDa
pI
5.2
Protein length
Gene length
function
riboflavin biosynthesis
product
riboflavin synthase (beta subunit)
essential
no
ec
2.5.1.9
synonyms
ribH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0054 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,427,892  2,428,356
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(2S)-2-hydroxy-3-oxobutyl phosphate + 5-amino-6-(D-ribitylamino)uracil --> 6,7-dimethyl-8-(1-D-ribityl)lumazine + H+ + 2 H2O + phosphate (according to UniProt)
Protein family
DMRL synthase family (single member, according to UniProt)
Structure
[PDB|1ZIS], [PDB|1RVV] (the [protein|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE])3-([protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH])60 lumazine synthase/riboflavin synthase complex) [Pubmed|7473709]
[AF|P11998]
Modification
acetylyated on K29 by [protein|8146A052E4E7844F781E7169C264EC927DEB7387|ribT] [pubmed|35495702]
[wiki|Localization]
cytoplasm [pubmed|34474681]
Expression and Regulation
Operons
genes
[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
description
[Pubmed|8159171]
regulation
expressed in the absence of FMN ([wiki|FMN-box]) [Pubmed|15808508]
binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR] to the [wiki|FMN-box] riboswitch can enforce expression even in the presence of FMN [pubmed|26494285]
the [wiki|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
FMN-box: RNA switch, via [wiki|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR], in [regulon|other_regulator:FMN-box|FMN-box]
[protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]: antitermination, [pubmed|26494285], in [regulon|protein:3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8159171], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]→[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]

2024-06-08 12:44:39

Jstuelk

99

3D660447137821317811200D29A5FC04A41E938E

05C8A4E892E7DB3D953FE72E8765638644759326

Biological materials
Mutant
BKE23250 ([gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATTCCCATCCTTTT,  downstream forward: _UP4_TAATTTGCTGAAAACAGTTT
BKK23250 ([gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATTCCCATCCTTTT,  downstream forward: _UP4_TAATTTGCTGAAAACAGTTT
References
Reviews
11395405
Original Publications
12456892,15808508,7473709,8159171,7934830,3100522,23270261,24442413,26494285,29087189,34474681,35495702

2A5DCBFAB51996F0DDEC964D5D178274AF86CE69

Page visits: 2832

Time of last update: 2024-06-21 08:14:14

Author of last update: Jstuelk