ptsH

ptsH
168

HPr, General component of the sugar [wiki|phosphotransferase system] (PTS)

locus
BSU_13900
Molecular weight
9.05 kDa
pI
4.58
Protein length
Gene length
function
PTS-dependent sugar transport and carbon catabolite repression
product
histidine-containing phosphocarrier protein HPr of the PTS
essential
no
ec
2.7.11.-
synonyms
ptsH, HPr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1925 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,459,384 1,459,650
Phenotypes of a mutant
the mutant cells are thinner and shorter than wild type cells [pubmed|34846166]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
HPr family (with [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh], according to UniProt)
[wiki|Domains]
HPr domain (aa 2-88) (according to UniProt)
Structure
[PDB|2FEP] [pubmed|16755587]
[PDB|2HID] (NMR) [Pubmed|9336834]
[PDB|1KKM] (complex of ''L. casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK] with ''B. subtilis'' HPr-Ser-P)
[PDB|1KKL] (complex of ''Lactobacillus casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK] with ''B. subtilis'' HPr)
[PDB|3OQM] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA] operator site)
[PDB|3OQN] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR] operator site)
[PDB|3OQO] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
[AF|P08877]
Modification
transient phosphorylation by [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|Enzyme I] of the PTS on His-15
regulatory phosphorylation on Ser-46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK] [Pubmed|2507315]
an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [PubMed|18757537]
weak phosphorylation on Ser-12 [Pubmed|17218307]
''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Ser-12 [Pubmed|20389117]
Paralogous protein(s)
[protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
description
[Pubmed|11902727]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]→[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]

2024-07-06 05:30:24

Jstuelk

89

f18fb98abd8f13ce4f268a312c4844b7c2224ad1

9C318C6E1750955A8C473FE06158A7E5F5C52794

genes
[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
description
[Pubmed|11902727]
regulation
expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-dependent [wiki|RNA switch] [PubMed|9765562], in [regulon|protein:BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]→[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]

2024-07-13 04:20:36

ghost

114

0d1ff574eb4a847a56452c8c7084e1e199118b30

EEB2B4E2EFD5EB6876956633E22D1305FFE807F7

Biological materials
Mutant
available in [wiki|Jörg Stülke]'s lab:
MZ303 (cat)
GP507 [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]1 (S46A)
GP506 ([gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-H15A)
GP778 ([gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
BKE13900 ([gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13900 ([gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Expression vectors
pGP438 (with N-terminal Strep-tag, in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
pAG2 (His-tag) [Pubmed|9237995], available in [wiki|Anne Galinier] lab
pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jrg Stlke]'s lab
pGP1415 (HPr, expression in ''B. subtilis'', from [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
pGP3628 expression of Strep-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH] by [wiki|pGP380] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1267, [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-cfp, available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
labs
[wiki|Jörg Stülke], University of Gttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[wiki|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
[wiki|Anne Galinier], University of Marseille, France
References
Reviews
24847021,17158705,11018147,9871918,18628769
Original Publications
36815589,16519689,12850135,17218307,16519689,17142398,12359875,1577686,9162046,11929549,9336834,7803390,7623661,2846556,8169206,9973552,15126459,10048041,12169607,9622354,10217795,17693724,18757537,9202047,7592487,15369672,14527945,2507315,8580838,19651770,8418852,26282429,1303754,1549615,20081037,20389117,20444094,22001508,22722928,23551403,15378759,26381121,9336834,23475962,16755587,37298508

29B793660E4D30C0656248F3EF403FEF76FB9025

Page visits: 13336

Time of last update: 2024-07-15 03:57:30

Author of last update: Jstuelk