lytD

lytD
168

peptidoglycan N-acetylglucosaminidase

locus
BSU_35780
Molecular weight
95.36 kDa
pI
9.94
Protein length
Gene length
function
major autolysin, cell separation
product
peptidoglycan N-acetylglucosaminidase
essential
no
ec
3.2.1.96
synonyms
lytD, cwlG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4193 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,684,826  3,687,468
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
hydrolysis of the glycosidic bond between N-acetyl--d-glucosamine residues and adjacent monosaccharides [Pubmed|18266855]
Endohydrolysis of the N,N'-diacetylchitobiosyl unit in high-mannose glycopeptides and glycoproteins containing the -(Man(GlcNAc)(2))Asn-structure. One N-acetyl-D-glucosamine residue remains attached to the protein, the rest of the oligosaccharide is released intact (according to UniProt)
Protein family
glycosyl hydrolase 73 family (with [protein|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG], according to UniProt)
[wiki|Domains]
3 SPOR domains (aa 70-149, aa 150-229, aa 230-311) (according to UniProt)
[wiki|SH3B domain] (aa 630-700) (according to UniProt)
Structure
[AF|P39848]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]
description
[Pubmed|7934877]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|7934877], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]

2024-06-18 01:29:36

ghost

66

8467072006a32884291fc7ab217f38d2ab105b54

FD03809277AD4D086652D8815296A3D4FB42F189

Biological materials
Mutant
GP3400 (Δ[gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]::neo trpC2), available in [wiki|Jörg Stülke]'s lab
1A788 ( ''lytD''::''tet''), [Pubmed|7934877], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A788&Search=1A788 BGSC]
1A792 ( ''lytD''::''tet''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
BKE35780 ([gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCTCCTCTTTCTT,  downstream forward: _UP4_TAAAAAACTTAGAAAGTTGC
BKK35780 ([gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCTCCTCTTTCTT,  downstream forward: _UP4_TAAAAAACTTAGAAAGTTGC
FLAG-tag construct
GP4405 ''lytD-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
18266855
Original Publications
7934877,19542270,18957862,21821766,38660441

29219315D31BA4ADE41687EFF17FE41D6C23D157

Page visits: 3693

Time of last update: 2024-06-20 22:00:53

Author of last update: Jstuelk