bkdB

bkdB
168

2-oxoisovalerate dehydrogenase (E2 subunit, lipoamide acyltransferase)

locus
BSU_24030
Molecular weight
45.67 kDa
pI
5.3
Protein length
Gene length
function
utilization of branched-chain keto acids
product
2-oxoisovalerate dehydrogenase (E2 subunit, lipoamide acyltransferase)
essential
no
ec
2.3.1.168
synonyms
bkdB, bfmBB, bfmB2, bkd

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,496,796  2,498,070
Phenotypes of a mutant
a strain lacking the [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB] operon and the [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des] gene exhibits strongly reduced membrane fluidity and eventual growth arrest [pubmed|35037270]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[protein] + 2-methylpropanoyl-CoA --> (R)-N6-(S8-2-methylpropanoyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 3-78) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 116-153) (according to UniProt)
[wiki|Cofactors]
lipoic acid (on Lys-44), can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
Structure
[PDB|3DUF] (Geobacillus stearothermophilus [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], 36% identity) [pubmed|19081062]
[AF|P37942]
Paralogous protein(s)
[protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]
[wiki|Localization]
Nucleoid (Heterogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
description
[Pubmed|12823818]
regulation
induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
regulatory mechanism
[protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]: activation, [Pubmed|10094682], in [regulon|protein:4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|10094682], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|10094682], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
Open in new tab

[gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]→[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]

2024-06-20 14:55:36

ghost

76

7b8921dc3f8fdb775067a1f92187895088ac1126

0BF3F61A9229E387986A64E3D2F9F647D24EA48A

Biological materials
Mutant
BKE24030 ([gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTATCCTCCCTTA,  downstream forward: _UP4_TAAATAAGCAAAAAGAGCAT
BKK24030 ([gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTATCCTCCCTTA,  downstream forward: _UP4_TAAATAAGCAAAAAGAGCAT
References
Reviews
27074917,38624243
Original Publications
12427936,15241682,10094682,10094682,16479537,12823818,28900027,19081062,31066113,35037270

262C9FD20C7A70B6F1FEB57735FA800F38EAB25A

Page visits: 4377

Time of last update: 2024-06-20 11:46:05

Author of last update: Jstuelk