metE

metE
168

methionine synthase

locus
BSU_13180
Molecular weight
86.64 kDa
pI
4.84
Protein length
Gene length
function
biosynthesis of methionine
product
methionine synthase
essential
no
ec
2.1.1.14
synonyms
metE, metC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0620 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,383,320 1,385,608
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
5-methyltetrahydropteroyltri-L-glutamate + L-homocysteine --> L-methionine + tetrahydropteroyltri-L-glutamate (according to UniProt)
Protein family
vitamin-B12 independent methionine synthase family (single member, according to UniProt)
Structure
[PDB|1T7L] (from ''Thermotoga maritima'', 44% identity, 61% similarity) [Pubmed|15630480]
[AF|P80877]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|17726680], S-cysteinylation after diamide stress (C719) [Pubmed|17611193]
Cys719 and Cys730 are S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
MetE is generally most strongly S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]
regulation
repressed by casamino acids [Pubmed|12107147]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]

2024-06-17 14:50:49

Jstuelk

59

a2c1a26ddf575e47d02ea8b1f4d126209fdafc94

CDE3048378AB7CEEA67FEC21DE6642EF6492A3D2

Biological materials
Mutant
1A607 ( ''metE''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A607&Search=1A607 BGSC]
BKE13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
BKK13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
References
Reviews
25852656
Original Publications
21749987,22938038,21749987,19258532,16194229,10094622,17611193,18039762,17726680,12107147,24313874,24163341,15378759,29794222

23F405D5B849E4EDC1D599F86C71DFD2E55C0305

Page visits: 2918

Time of last update: 2024-06-21 03:40:13

Author of last update: Melvin.boenninger