panU

panU
168

S protein of [metabolite|pantothenate] [wiki|ECF transporter]

locus
BSU_10370
Molecular weight
19.87 kDa
pI
10.68
Protein length
Gene length
function
uptake of [metabolite|pantothenate]
product
S protein of [metabolite|pantothenate] [wiki|ECF transporter]
essential
no
synonyms
yhfU, bioY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1268 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,111,925  1,112,485
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
uptake of [metabolite|pantothenate] [https://www.biorxiv.org/content/10.1101/2024.04.17.589903v1.full.pdf bioRxiv]
Protein family
bioY family (with [protein|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG], according to UniProt)
Structure
[PDB|4DVE] (BioY from ''Lactococcus lactis'', 35% identity, 71% similarity) [Pubmed|22891302]
[AF|O07620]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
description
[Pubmed|22383849]
regulation
repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
regulatory mechanism
[protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]: repression, [Pubmed|11717296], in [regulon|protein:F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA regulon]
additional information
weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
Open in new tab

[gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU]→[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]

2024-06-20 06:58:49

ghost

88

89c1778bebc3b239c3d7430040a2e0383ed84687

B42B3F0DE33D475226AC600D1867A0778BBB154A

Biological materials
Mutant
GP4704 & GP4789 (trpC2 Δ[gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU]::neo), available in [wiki|Jörg Stülke]'s lab
MGNA-B281 (yhfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1280 NBRP B. subtilis, Japan]
BKE10370 ([gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAATCCTCCAAAAA,  downstream forward: _UP4_TTTACAAAAGGAGGATGACA
BKK10370 ([gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAATCCTCCAAAAA,  downstream forward: _UP4_TTTACAAAAGGAGGATGACA
References
21437340,20497229,22574898,24362466,17301237,22891302,18763711,22383849,11717296,12368242

22215066A7BEA4E53189DE6639C19D1AD86DA7F4

Page visits: 4814

Time of last update: 2024-06-21 01:33:18

Author of last update: Robert.warneke