gcvPB

gcvPB
168

glycine decarboxylase (subunit 2)

locus
BSU_24550
Molecular weight
54.26 kDa
pI
5.28
Protein length
Gene length
function
glycine utilization
product
glycine decarboxylase (subunit 2)
essential
no
ec
1.4.4.2
synonyms
gcvPB, yqhK, gcvP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1003 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,545,410  2,546,876
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
glycine + H+ + N6-lipoyl-L-lysyl-[glycine-cleavage complex H protein] --> (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[glycine-cleavage complex H protein] + CO2 (according to UniProt)
Protein family
GcvP family (with [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA], according to UniProt)
[wiki|Cofactors]
pyridoxal phosphate (according to UniProt)
Structure
[PDB|1WYT] (the [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB] complex from Thermus thermophilus, 56% identity) [pubmed|15791207]
[AF|P54377]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
description
[Pubmed|15472076]
regulation
induced by glycine [Pubmed|15472076]
the [wiki|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
Gly-box: RNA switch, [pubmed|31992591], in [regulon|other_regulator:Gly-box|Gly-box]
Open in new tab

[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]→[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]

2024-06-03 08:29:46

Jstuelk

55

b8399a8069749ebce96a5673beef55862123ad69

18A61526FCBD278A97D718FA1F476B3A75682C1F

Biological materials
Mutant
MGNA-C470 (yqhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2468 NBRP B. subtilis, Japan]
BKE24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT,  downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
BKK24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT,  downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
References
12107147,15472076,28516784,15791207

20175DF9FCF07C34A05C572B089C33D1E1FE6DF2

Page visits: 3417

Time of last update: 2024-06-12 17:33:04

Author of last update: Melvin.boenninger