yuxN

yuxN
168

transcription repressor ([wiki|TetR family])

locus
BSU_33030
Molecular weight
33.16 kDa
pI
7.66
Protein length
Gene length
function
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] stability
product
transcription repressor
essential
no
synonyms
yuxN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,388,113  3,388,988
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 2-62) (according to UniProt)
Structure
[AF|P40950]
Expression and Regulation
Operons
genes
[gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]
description
[Pubmed|22383849]
Open in new tab

[gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]

2024-06-19 23:47:12

Jstuelk

42

284996c309403c14cb1a2268d33f3ab2326dfc0f

98C2B1B017C43EF73FAC790EDCCB0FC25223908D

Biological materials
Mutant
MGNA-B208 (yuxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1207 NBRP B. subtilis, Japan]
BKE33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG,  downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
BKK33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG,  downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
References
20525796,30001325

1D6C340264B8A75727E202AD2E37053091C94013

Page visits: 2001

Time of last update: 2024-07-13 06:05:16

Author of last update: Melvin.boenninger