metC

metC
168

cystathionine beta-lyase

locus
BSU_11880
Molecular weight
42.33 kDa
pI
5.76
Protein length
Gene length
function
biosynthesis of methionine
product
cystathionine beta-lyase
essential
no
ec
4.4.1.8
synonyms
metC, yjcJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0626 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,259,606 → 1,260,778
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
H2O + L,L-cystathionine --> L-homocysteine + NH4+ + pyruvate (according to UniProt)
S-substituted L-cysteine + H2O --> thiol + NH4+ + pyruvate (according to UniProt)
Protein family
trans-sulfuration enzymes family (with [protein|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB] and [protein|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI], according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|4L0O] (from Helicobacter pylori, 51% identity)
[AF|O31632]
Paralogous protein(s)
[protein|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB], [protein|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI]-[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]
description
[Pubmed|11832514]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination, in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11832514], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI]→[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]

2024-06-16 17:55:23

Jstuelk

60

e7bcabc481203e5715faf59d0740a493d058794d

A78F2908B4A6A8C859B2C706984458FF45D08793

Biological materials
Mutant
MGNA-B299 (yjcJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1298 NBRP B. subtilis, Japan]
1A944 ( ''metC''::''kan''), [Pubmed|11832514], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A944&Search=1A944 BGSC]
1A940 ( ''metC''::''spec''), [Pubmed|11832514], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A940&Search=1A940 BGSC]
BKE11880 (Δ[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGGGTTTCCAGCGTCCAAT,  downstream forward: _UP4_TAAAAAAGAAGCCGGGGATA
BKK11880 (Δ[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGGGTTTCCAGCGTCCAAT,  downstream forward: _UP4_TAAAAAAGAAGCCGGGGATA
References
19258532,11832514,18039762,12107147

1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724

Page visits: 4352

Time of last update: 2024-06-22 17:43:50

Author of last update: Melvin.boenninger