lipM

lipM
168

octanoyltransferase

locus
BSU_24530
Molecular weight
32.09 kDa
pI
5.93
Protein length
Gene length
function
biosynthesis of lipoic acid
product
octanoyltransferase
essential
no
ec
2.3.1.181
synonyms
lipM, yqhM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0095 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,543,968  2,544,804
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
transfers the octanoyl moiety from octanoyl-acyl carrier protein to the lipoyl domains of the 2-oxoacid dehydrogenases via a thioester-linked octanoyl-LipM intermediate [Pubmed|20882995]
L-lysyl-[protein] + octanoyl-[ACP] --> H+ + holo-[ACP] + N6-octanoyl-L-lysyl-[protein] (according to UniProt)
Protein family
octanoyltransferase LipM family (single member, according to UniProt)
[wiki|Domains]
[wiki|BPL/LPL catalytic domain] (aa 33-248) (according to UniProt)
Structure
[PDB|3A7A] (from ''E. coli'', 25% identity) [Pubmed|20089862]
[AF|P54511]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]-[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]
description
[pubmed|22383849]
Open in new tab

[gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]->[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]

2024-06-19 22:14:07

Jstuelk

48

43142196e46b9630ee956a30cb1c43887eb0465a

68845A224A7971C2B25ADC30013D1BE3E2F7504C

Biological materials
Mutant
MGNA-C469 (yqhM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2467 NBRP B. subtilis, Japan]
BKE24530 ([gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAGACCTTCCTTAC,  downstream forward: _UP4_TAAACAGGGCTTTTGACCCG
BKK24530 ([gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAGACCTTCCTTAC,  downstream forward: _UP4_TAAACAGGGCTTTTGACCCG
References
Reviews
27074917,38624243
Original Publications
20882995,20089862

19CEB80CF637F1FED7C493EF743B4BFA632C8D44

Page visits: 2618

Time of last update: 2024-06-19 19:24:23

Author of last update: Jstuelk