yoaC

yoaC
168

similar to xylulokinase

locus
BSU_18550
Molecular weight
53.94 kDa
pI
4.86
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yoaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1070 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,022,561  2,024,024
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|FGGY kinase family] (according to UniProt)
Structure
[PDB|2W41] (glycerol kinase from Plasmodium falciparum, 25% identity) [pubmed|19040641]
[AF|O34861]
Expression and Regulation
Operons
genes
[gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]-[gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]-[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
description
[Pubmed|10094622]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]→[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]

2024-06-18 00:48:49

Jstuelk

68

0b52fbe0bb9d5809477459667c1400f3004ff193

D97B471EE690CF8F0B0DBE37D2272E2DA13A7F83

Biological materials
Mutant
MGNA-A834 (yoaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/834 NBRP B. subtilis, Japan]
BKE18550 ([gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATTCTGTTAGCCTCCT,  downstream forward: _UP4_TAAGACGGAATTTCTGCTGT
BKK18550 ([gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATTCTGTTAGCCTCCT,  downstream forward: _UP4_TAAGACGGAATTTCTGCTGT
References
12107147,18039762,19040641

182B8EFA41DAE695B008CBAA561F3730D11750B1

Page visits: 1393

Time of last update: 2024-06-22 01:54:23

Author of last update: Melvin.boenninger