cspB

cspB
168

major cold-shock protein

locus
BSU_09100
Molecular weight
7.23 kDa
pI
4.34
Protein length
Gene length
function
RNA chaperone
product
major cold-shock protein
essential
no
synonyms
cspB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1278 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
984,262 984,465
Phenotypes of a mutant
elongated cells in the stationary phase [pubmed|34361870]
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB] [gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD] double mutants are poorly viable, rapidly acquire suppressor mutations that result in overexpression of [gene|D453E1E7D4256B56AFB2149731E08B104D59431B|cspC] or loss of the [gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg] gene [pubmed|34361870]
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB] [gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD] double mutants have lost genetic competence [pubmed|34361870]
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB] [gene|D453E1E7D4256B56AFB2149731E08B104D59431B|cspC] double mutants are poorly viable at 15°C [pubmed|34361870]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
[wiki|Domains]
[wiki|CSD domain] (aa 4-63) (according to UniProt)
Structure
[PDB|2I5M] [pubmed|17481655]
[PDB|2ES2] [Pubmed|16780871]
[PDB|1CSP] [Pubmed|8321288]
[PDB|1NMG] (NMR)
[PDB|3PF4] (in complex with r(GUCUUUA)) [Pubmed|22128343]
[AF|P32081]
Paralogous protein(s)
[protein|D453E1E7D4256B56AFB2149731E08B104D59431B|cspC], [protein|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]
[wiki|Localization]
cytoplasm (according to Swiss-Prot), cytoplasma, colocalizes with the ribosomes [Pubmed|16352840]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]
description
[Pubmed|1400185]
regulation
strong constitutive expression [Pubmed|34361870]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1400185], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]

2024-05-22 00:44:53

Jstuelk

78

54C038C5FE0E750544A71B8F080685B59076BADA

88C52DFFD89358361C43F4B8F10E123E9C8565A8

Biological materials
Mutant
GP1968 ([gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::cat trpC2) available in [wiki|Jörg Stülke]'s lab [pubmed|34361870]
GP3251 ([gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::tet trpC2) available in [wiki|Jörg Stülke]'s lab
BKE09100 ([gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA
BKK09100 ([gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA
Expression vectors
pGP3140: Expression of 6XHIS-SUMO-tagged ''cspB'' by [wiki|pETSUMOadapt] in ''E. coli'', available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP3283 ([gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::lacZ cat, based on [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab [pubmed|34361870]
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
Reviews
Original Publications
12399512,12171653,11752341,11717297,12838604,8321289,9533624,9379903,8294017,8755892,9914312,11591689,7476164,1409560,16352840,9920884,1400185,12427936,8307174,7703860,22128343,23199363,15378759,21124848,16780871,26809452,8321288,17481655,30738179,31756296,32060391,32786103,32949815,31876031,34361870,34613715,38656763

16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2

Page visits: 6844

Time of last update: 2024-05-22 07:48:34

Author of last update: Jstuelk