ktrC

ktrC
168

glutamate-controlled potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD], peripheric membrane component

locus
BSU_14510
Molecular weight
24.20 kDa
pI
5.63
Protein length
Gene length
function
potassium uptake
product
glutamate-controlled potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD], peripheric membrane component
essential
no
synonyms
ktrC, ylxV, yzaC, ykqB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,520,531  1,521,196
Phenotypes of a mutant
inactivation of [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC] facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate [pubmed|33481774]
inactivation of [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC] facilitates the adaptation a strain lacking c-di-AMP to growth on complex medium under anaerobic conditions [pubmed|33481774]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
KtrA potassium transport family (with [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA], according to UniProt)
[wiki|Domains]
contains a [wiki|RCK_N domain] at the N-terminus (aa 4-126)(according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a c-di-AMP-binding [wiki|RCK_C domain] at the C-terminus (aa 135-219) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]
Structure
[PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex, 56% identity) [Pubmed|23598340]
[PDB|6I8V] ([protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC] in complex with ATP) [Pubmed|30753894]
[PDB|4XTT] (the ''S. aureus'' [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] [wiki|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]
[AF|P39760]
Effectors of protein activity
binds ADP and ATP [pubmed|30753894]
the protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake [Pubmed|30753894]
the affinity of [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD] for potassium is strongly increased in the presence of glutamate [pubmed|32253343]
Kinetic information
the [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|search|KtrD ]channel has a low affinity for potassium, this is determined by [protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD] [pubmed|30753894]
the affinity of [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD] for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) [pubmed|32253343]
Paralogous protein(s)
[protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]
[wiki|Localization]
peripheral membrane protein [Pubmed|12562800]
Expression and Regulation
Operons
genes
[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
description
[Pubmed|12562800]
regulation
constitutively expressed [Pubmed|12562800]
Open in new tab

[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]

2024-06-15 23:56:50

ghost

80

bd868f8a50b8d6309b23941385d437b223642c99

3AFCA66A191BB0AEE34910AC199DAC446E655C34

genes
[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]-[gene|22DBF4D1F93519A95E6BCC0FB1AC2387DF444E27|ykqA]-[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
description
[Pubmed|22383849]
regulation
constitutively expressed [Pubmed|12562800]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|8002615], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002614], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]→[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]

2024-06-15 12:52:16

ghost

123

13fec2f53403530776626371dde75ae36f8ffdcc

89B46AE807A9C6714638DCFE0DFEACD209BF81BB

Biological materials
Mutant
MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]
GHB6 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''spec''), [Pubmed|12562800] (available in [wiki|Erhard Bremer]'s and [wiki|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955
GP2264 (Δ[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''aphA3''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2048 (Δ[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]'::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2079 (Δ[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2771 (Δ[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''spec''), available in [wiki|Jörg Stülke]'s lab
GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
BKE14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA,  downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
BKK14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA,  downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
Expression vectors
pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP2994: expression of Strep-[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC] by [wiki|pGP380] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2995: expression of [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-Strep by [wiki|pGP382] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[wiki|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[wiki|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,27935846,25838295,31361596,32472931,32603625,33798529,33288383
Original Publications
12562800,23671116,23598340,28420751,28504641,30753894,31061098,31506295,32253343,33481774,38652747,38719864

15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623

Page visits: 8159

Time of last update: 2024-06-20 17:17:10

Author of last update: Jstuelk