

phosphodiesterase, controls bistable gene expression, required for nanotube formation

Molecular weight
29.14 kDa
Protein length
Gene length
control of bistable gene expression

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1692 (Galperin et al., 2021)

This gene is a member of the following regulons

1,768,941  1,769,735
Phenotypes of a mutant
strong overexpression of ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' [Pubmed|21856853]
defective in [wiki|biofilm formation] [Pubmed|21856853,22113911]
selective pressure for the inactivation of the [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] gene to allow [wiki|biofilm formation] [pubmed|30181249]
the phenotypes of the ''ymdB'' mutant can be suppressed by overexpression of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' [Pubmed|21856853]
inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
increased expression of genes encoding small acid-soluble proteins [Pubmed|24163345]
increased intracellular levels of cyclic AMP [Pubmed|26904951]
abberant colony development, reduced colony size [Pubmed|26904951]
reduced formation of nanotubes [Pubmed|26906740]
inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' reduces sporulation efficiency to 11.4% that of wild type cells [Pubmed|26735940]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
phosphodiesterase activity toward 2',3'-cAMP [Pubmed|24163345]
nucleoside 2',3'-cyclic phosphate + H2O --> nucleoside 3'-phosphate + H+ (according to UniProt)
[PDB|4B2O] [Pubmed|24163345]
Expression and Regulation
additional information
the [wiki|transcription] terminator between ''[wiki|rny]'' and ''[wiki|ymdB]'' is strong and [wiki|NusA]-independent [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab


2024-07-11 02:22:36





Biological materials
MGNA-B070 (ymdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1069 NBRP B. subtilis, Japan]
GP583 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc), available in [wiki|Jörg Stülke]'s lab [Pubmed|21856853]
GP922 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::cat), available in [wiki|Jörg Stülke]'s lab [Pubmed|21856853]
GP921 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc) NCIB3610 derivative, available in [wiki|Jörg Stülke]'s lab [Pubmed|21856853]
GP969 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''(E39Q)-cat) inactive enzyme, available in [wiki|Jörg Stülke]'s lab [Pubmed|24163345]
GP1558 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3; cassette w/o terminator), available in [wiki|Jörg Stülke]'s lab
GP1573 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3), available in [wiki|Jörg Stülke]'s lab
GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [wiki|Jörg Stülke]'s lab
BKE16970 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT,  downstream forward: _UP4_TAGTTGAACATATGGTTATT
BKK16970 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT,  downstream forward: _UP4_TAGTTGAACATATGGTTATT
Expression vectors
for expression/ purification from ''B. subtilis'', in [wiki|pBQ200]: pGP1039, available in [wiki|Jörg Stülke]'s lab
for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], in [wiki|pGP380]: pGP1041, available in [wiki|Jörg Stülke]'s lab
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [wiki|SPINE], in [wiki|pGP382]: pGP1919, available in [wiki|Jörg Stülke]'s lab
for expression/ purification from ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP1040, available in [wiki|Jörg Stülke]'s lab
for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP1917, available in [wiki|Jörg Stülke]'s lab [Pubmed|24163345]
GP970 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1018 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
Original Publications
Functional and structural analysis of orthologs in other organisms


Page visits: 7683

Time of last update: 2024-07-15 07:19:09

Author of last update: Jstuelk