rok

rok
168

chromosomal loop anchor, repressor of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], nucleoid associated protein that serves to help repress expression of A T-rich genes, many of which appear to have been acquired by horizontal gene transfer

locus
BSU_14240
Molecular weight
21.69 kDa
pI
9.7
Protein length
Gene length
function
control of genome organization, silencing of horizontally acquired genes
product
chromosomal loop anchor
essential
no
synonyms
rok, ykuW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,493,787  1,494,362
Phenotypes of a mutant
higher excision rate of the conjugative transposon ICEBs1 [Pubmed|21085634]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
binds to extended regions of the ''B. subtilis'' genome that are characterized by a high A+T content and are known or believed to have been acquired by horizontal gene transfer [Pubmed|21085634]
[wiki|Domains]
N-terminal multimerization domain [pubmed|35075232]
C-terminal DNA-binding domain [pubmed|35075232]
Structure
[PDB|5ZUX] (complexed with DNA) [Pubmed|30252102]
[PDB|5ZUZ] [Pubmed|30252102]
[AF|O34857]
Effectors of protein activity
activity is modulated by interaction with [protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860]
Expression and Regulation
Operons
genes
[gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]
description
[Pubmed|12354229]
regulation
repressed by [protein|search|Rok] [Pubmed|11849533]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|11849533], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|11849533], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|11849533], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]

2024-07-12 22:47:30

ghost

106

fa3e5b3d68b7b455542698c7ba4a901cf5706260

58085A050964C44F86A2F33ABF53D81E9C79BDB9

Biological materials
Mutant
MGNA-B345 (ykuW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1344 NBRP B. subtilis, Japan]
BKE14240 ([gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCAATGTACCCCCT,  downstream forward: _UP4_TAAATATAAAGAAAAACTGC
BKK14240 ([gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCAATGTACCCCCT,  downstream forward: _UP4_TAAATATAAAGAAAAACTGC
References
Reviews
19995980
Original Publications
21085634,12354229,14651647,11849533,21097620,15743949,27375604,27902860,30252102,30808982,33973337,34961960,35075232,35241653,36408910,38511404

1508770D5BCA5739D13E3ABD11CC5C103C07FF25

Page visits: 4556

Time of last update: 2024-07-15 03:20:03

Author of last update: Jstuelk