

Enzyme I, general (non sugar-specific) component of the PTS

Molecular weight
62.90 kDa
Protein length
Gene length
PTS-dependent sugar transport
phosphotransferase system (PTS) enzyme I

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1080 (Galperin et al., 2021)

This gene is a member of the following regulons

1,459,650 1,461,362
Phenotypes of a mutant
poorly transformable [pubmed|28189581]
Visit Visit
The protein
Catalyzed reaction/ biological activity
L-histidyl-[protein] + [metabolite|phosphoenolpyruvate] --> N-phospho-L-histidyl-[protein] + [metabolite|pyruvate] (according to UniProt)
[metabolite|PEP]-dependent autophosphorylation on His-189, transfer of the phosphoryl group to [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] (His-15)
Protein family
[wiki|PEP-utilizing enzyme family] (according to UniProt)
HPr binding site (N-Terminal Domain)
[metabolite|pyruvate] binding site (C-Terminal Domain)
pyrophosphate/phosphate carrier histidine (central Domain)
[PDB|2WQD] (Enzyme I from ''Staphylococcus aureus'', 68% identity) [Pubmed|19801641]
transient autophosphorylation on His-189
''in vivo'' also phosphorylated on Ser-34 or Ser-36 [Pubmed|17218307]
cytoplasm, even distribution [Pubmed|23475962]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-06 05:30:24





expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-dependent [wiki|RNA switch] [PubMed|9765562], in [regulon|protein:BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-13 04:20:36





Biological materials
available in [wiki|Jörg Stülke]'s lab:
GP864 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::ermC)
GP778 ([gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
BKE13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
BKK13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
Expression vectors
pAG3 (His-tag) [Pubmed|9237995], available in [wiki|Galinier] lab
for expression, purification in ''E. coli'' (His-tag), in [wiki|pWH844]: pGP813 available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1268, [gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]-cfp, available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
[wiki|Jörg Stülke], University of Göttingen, Germany [ Homepage]
Original Publications


Page visits: 6129

Time of last update: 2024-07-14 21:15:56

Author of last update: Jstuelk