

[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA], response to iron limitation

Molecular weight
6.88 kDa
Protein length
Gene length
RNA chaperone
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA], response to iron limitation

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

506,322  506,501
Phenotypes of a mutant
transcription profile of a ''[gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA] [gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'' double mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
Visit Sartorius.com Visit Sartorius.com
The protein
Expression and Regulation
induced by iron starvation (third wave, under extreme starvation, iron sparing response) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab


2024-07-02 22:31:12





Biological materials
BKE04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC,  downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
BKK04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC,  downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT


Page visits: 4896

Time of last update: 2024-07-14 13:29:07

Author of last update: Jstuelk