argF

argF
168

[metabolite|ornithine] carbamoyltransferase

locus
BSU_11250
Molecular weight
34.51 kDa
pI
4.97
Protein length
Gene length
function
biosynthesis of [metabolite|arginine]
product
[metabolite|ornithine] carbamoyltransferase
essential
no
ec
2.1.3.3
synonyms
argF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0078 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,203,461  1,204,420
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[metabolite|carbamoyl-P] + L-[metabolite|ornithine] --> H+ + L-[metabolite|citrulline] + [metabolite|phosphate] (according to UniProt)
Protein family
ATCase/OTCase family (with [protein|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB], according to UniProt)
Structure
[PDB|2EF0] (from ''Thermus thermophilus hb8'', 48% identity, 63% similarity)
[AF|P18186]
Effectors of protein activity
inhibited at high [metabolite|ornithine] concentrations, inhibition is enhanced by interaction with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF] in the presence of exogenous [metabolite|arginine] (1 mM) [pubmed|4216455]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
description
[Pubmed|7511775]
regulation
repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]) [Pubmed|1312212]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: repression, [Pubmed|1312212], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24843172], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]→[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]

2024-06-08 06:37:41

Jstuelk

81

bd8576e7d6b5ef98ec61ff0587a9708cd8d39155

DA268D208C03E6C5DAF0361E4714668AC025F3EA

Biological materials
Mutant
1A605 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A605&Search=1A605 BGSC]
1A606 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A606&Search=1A606 BGSC]
BKE11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT,  downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
BKK11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT,  downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
GP3710 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3852: expression of ''argF'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP3865: expression of ''argF''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP3959 ''argF-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
6096675,24843172,12107147,1312212,7511775,4216455

11E7D77EF9439F817C10BF5D9671C5AE66AF06DC

Page visits: 5202

Time of last update: 2024-06-20 13:29:22

Author of last update: Jstuelk