cspD

cspD
168

cold shock protein

locus
BSU_21930
Molecular weight
7.17 kDa
pI
4.31
Protein length
Gene length
function
RNA chaperone
product
cold shock protein
essential
no
synonyms
cspD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1278 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,307,905 2,308,105
Phenotypes of a mutant
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB] [gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD] double mutants are poorly viable, rapidly acquire suppressor mutations that result in overexpression of [gene|D453E1E7D4256B56AFB2149731E08B104D59431B|cspC] or loss of the [gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg] gene [pubmed|34361870]
[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB] [gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD] double mutants have lost genetic competence [pubmed|34361870]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
[wiki|Domains]
[wiki|CSD domain] (aa 4-63) (according to UniProt)
Structure
[PDB|1C9O] (from ''B. caldolyticus'', 86% identity) [Pubmed|10736231]
[AF|P51777]
Paralogous protein(s)
[protein|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB], [protein|D453E1E7D4256B56AFB2149731E08B104D59431B|cspC]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]
description
[pubmed|22383849]
expression
strong constitutive expression [Pubmed|34361870]
Open in new tab

[gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]

2024-05-14 10:57:27

Jstuelk

66

CE5C78259E09AA3AD33DD6FA66E5DCB0E85DCB5B

63D0853793A9B47C57432809A3B339EB393E3B45

Biological materials
Mutant
GP2614 ([gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::''aphA3''), available in [wiki|Jörg Stülke]'s lab [pubmed|34361870]
MGNA-A874 (cspD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/874 NBRP B. subtilis, Japan]
BKE21930 ([gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTAATTCCTCCT, downstream forward: _UP4_TAAACTCAATACATGATGAT
BKK21930 ([gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTAATTCCTCCT, downstream forward: _UP4_TAAACTCAATACATGATGAT
Expression vectors
pGP2164: expression of ''cspD''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2165: expression of Strep-''cspD'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP3286 ([gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::lacZ cat), available in [wiki|Jörg Stülke]'s lab [pubmed|30957856]
References
Reviews
12171653,12838604
Original Publications
12399512,11752341,11717297,9920884,12427936,11591689,9379903,17981983,15378759,10736231,31876031,34157109,34361870

0F89D0B03F54B283CDD99A940D43C18E6B5703BB

Page visits: 3125

Time of last update: 2024-05-23 07:27:29

Author of last update: Jstuelk