

UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase, required for extracellular polysaccharide synthesis

Molecular weight
42.76 kDa
Protein length
Gene length
[category|SW.4.1.2|Biofilm formation], biosynthesis of UDP-N,N’-diacetylbacillosamine (with [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC] and [protein|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM])
UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase
epsN, yvfE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0399 (Galperin et al., 2021)

This gene is a member of the following regulons

3,515,062  3,516,228
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
UDP-2,6-dideoxy 2-acetamido 4-keto glucose + glutamate --> UDP-2,6-dideoxy 2-acetamido 4-amino glucose + 2-oxoglutarate [pubmed|29982582]
Protein family
DegT/DnrJ/EryC1 family (with [protein|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC], according to UniProt)
pyridoxal phosphate [pubmed|29982582]
[PDB|1O61] (from Campylobacter jejuni, 46% identity) [wiki|16021622]
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A064 (yvfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/64 NBRP B. subtilis, Japan]
BKE34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA,  downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
BKK34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA,  downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
Research papers
The EAR [wiki|RNA switch]


Page visits: 3782

Time of last update: 2024-07-15 06:55:59

Author of last update: Jstuelk