aprE

aprE
168

major extracellular alkaline protease

locus
BSU_10300
Molecular weight
39.37 kDa
pI
9.34
Protein length
Gene length
function
protein degradation
product
extracellular alkaline serine protease (subtilisin E)
essential
no
synonyms
aprE, sprE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,104,423  1,105,568
Phenotypes of a mutant
impaired biofilm architecture [pubmed|38922753]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Hydrolysis of proteins with broad specificity for peptide bonds, and a preference for a large uncharged residue in P1. Hydrolyzes peptide amides(according to UniProt)
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
Inhibitor I9 domain (aa 38-109) (according to UniProt)
[wiki|Peptidase S8 domain] (aa 111-380) (according to UniProt)
Structure
[PDB|1SBC]
[AF|P04189]
[wiki|Localization]
secreted (according to Swiss-Prot),  extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]
description
[pubmed|22383849]
regulation
repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] [Pubmed|1898931]
induced in the presence of external [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX] [pubmed|29449835]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|1898931], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|1906467], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|2504584], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|12950930,15598897,2447063], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|26728191], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2447063], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
in a triple ''[wiki|abrB] [wiki|codY] [wiki|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
Open in new tab

[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]

2024-07-15 22:58:58

Jstuelk

61

121ffe70e800e6a61942dad99d4adbe1a7d0d708

5C777B5A576DEF3DFD930F88AF6E3E8269A0737C

additional information
expression is increased in a [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] mutant due to the presence of increased levels of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P [pubmed|28800172]
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT,  downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
BKK10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT,  downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
Antibody
**
References
Reviews
34410368,35019178
Original Publications
19710937,3082852,2447063,2447062,19251843,18414485,6322190,12884008,15126467,1898931,1906467,2504584,18957862,11101663,12055299,3131303,1906467,15598897,11325965,14688235,21099137,22745669,23563549,23563567,24115457,25315053,12950930,26728191,28800172,29449835,24279884,37527273,38158017,38922753

0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D

Page visits: 13865

Time of last update: 2024-07-16 09:07:49

Author of last update: Jstuelk