sigM

sigM
168

[wiki|RNA polymerase] ECF-type [wiki|sigma factor] [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM], required to prioritize carrier lipid (undecaprenyl-phosphate) utilization for peptidoglycan synthesis

locus
BSU_09520
Molecular weight
19.26 kDa
pI
6.77
Protein length
Gene length
function
adaptation to inhibitors of peptidoglycan synthesis
product
[wiki|RNA polymerase] ECF-type [wiki|sigma factor] [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]
essential
no
synonyms
sigM, yhdM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1595 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,029,577  1,030,068
Phenotypes of a mutant
SigM is essential for growth and survival in nutrient broth (NB) containing 1.4 M NaCl [Pubmed|10216858]
''sigM'' mutants form aberrantly shaped cells, which swell and lyse spontaneously during growth in NB medium containing increased levels (0.35-0.7 M) of a wide range of different salts [Pubmed|10216858]
increased sensitivity towards beta-lactam antibiotics [Pubmed|22211522]
a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
[wiki|ECF subfamily] (according to UniProt)
Structure
[PDB|5WUQ] ([protein|search|SigW ]in complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW], 32% identity) [pubmed|28319136]
[AF|O07582]
Effectors of protein activity
expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [Pubmed|23632331]
shortage of available bactoprenol causes [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] activation [Pubmed|23632331]
antibiotics that block UndP recycling result in activation of SigM [pubmed|38683856]
SigM is released from the YhdL-YhdK complex upon undecaprenyl-phosphate limitation [pubmed|38683856]
Additional information
Expression of the [wiki|SigM regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000213 PRODORIC2 database]
Expression and Regulation
Operons
genes
[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]
description
[Pubmed|9573210]
regulation
induced by glucose [Pubmed|27965645]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9573210], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|9573210,18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
additional information
expression of [protein|search|CsbB] in the absence of [protein|search|YfhO] causes constitutive activation of [protein|search|SigM] [PubMed|23632331]
Open in new tab

[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]→[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]

2024-05-30 13:44:37

ghost

97

fb4e4633900f4ef286077c42a3c137436842759c

3F70EAF5AFE9E64A7150341483663D9A7347A835

Biological materials
Mutant
1A906 (''sigM''::''kan''), [Pubmed|12207695], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A906&Search=1A906 BGSC]
BP97 (Δ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK])::aphA3), available in [wiki|Fabian Commichau]'s lab
BP129 (Δ''sigM::aphA3''), available in [wiki|Fabian Commichau]'s lab
BKE09520 ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT,  downstream forward: _UP4_AAAGCACTTTATAATAGAGG
BKK09520 ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT,  downstream forward: _UP4_AAAGCACTTTATAATAGAGG
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
24921931,26901131,27344142,29343670
Other original publications
22362028,18394148,14993308,12399481,12775685,12207695,18820022,15838020,19047346,14651641,16151214,19465659,19745567,10216858,20057163,23103977,23632331,23070162,22211522,20817771,25918422,26399770,27965645,28319136,30715747,31626625,33114184,38683856
The [wiki|SigM regulon]
18179421,17675383,17434969

081DF3EE9FA56209D648C7677188C61CE3AA8E41

Page visits: 14304

Time of last update: 2024-06-20 22:18:24

Author of last update: Jstuelk