bglS

bglS
168

endo-beta-1,3-1,4 glucanase

locus
BSU_39070
Molecular weight
27.12 kDa
pI
6.48
Protein length
Gene length
function
lichenan degradation
product
endo-beta-1,3-1,4 glucanase
essential
no
ec
3.2.1.73
synonyms
bglS, bgl, licS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2273 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,011,842  4,012,570
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Hydrolysis of (1->4)-beta-D-glucosidic linkages in beta-D-glucans containing (1->3)- and (1->4)-bonds (according to UniProt)
Protein family
glycosyl hydrolase 16 family (single member, according to UniProt)
[wiki|Domains]
GH16 domain (aa 29-242) (according to UniProt)
Structure
[PDB|3O5S]
[AF|P04957]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]
description
[Pubmed|8606172]
regulation
expressed in the stationary phase (temporal activation) [Pubmed|8245830]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8245831], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]: antitermination, via binding to an [wiki|RNA switch], in [regulon|protein:FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8606172], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]

2024-07-13 00:41:03

ghost

69

91e1952956e4eaadf2db4ce5361740953587bd55

232A602B1DE02FD0395CA2849617588CAA2ADF97

genes
[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]
description
[Pubmed|8606172]
regulation
expressed in the stationary phase (temporal activation) [Pubmed|8245830]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8606172], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]→[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]

2024-07-13 00:40:04

ghost

72

c53f5f9d65bee2f49b36b261b08f54a3681748a8

E04D349CE33F16260854D95835D7F11AFB892F8F

genes
[gene|6BC5A936D8EDE7087C3F6293A2873EC5352FE5EF|yxiP]-[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]
description
[Pubmed|22383849]
Open in new tab

[gene|6BC5A936D8EDE7087C3F6293A2873EC5352FE5EF|yxiP]→[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]

2024-07-13 00:41:02

Jstuelk

99

c71d4e27ae884ff063a0224636e47b3376f616d1

E9284413C9C634EA6CE5E83A3A68A4BC61C0C559

Biological materials
Mutant
GP427 ([gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::erm), BGW7 (cat), both available in [wiki|Jörg Stülke]'s lab
BKE39070 ([gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGGCATTCCCCTTTC,  downstream forward: _UP4_TAATGCCAAATGTGAAAGAG
BKK39070 ([gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGGCATTCCCCTTTC,  downstream forward: _UP4_TAATGCCAAATGTGAAAGAG
References
18957862,12850135,6087283,8245830,8245831,8606172,23459129,24391357,24659048,25808979,28084659,28235843,30733736,35176056

044A0EBC8798B110E719B73664EB80F53112D8DE

Page visits: 5449

Time of last update: 2024-07-15 00:26:42

Author of last update: Jstuelk