speA

speA
168

[metabolite|arginine] decarboxylase, required for [wiki|biofilm formation]

locus
BSU_14630
Molecular weight
53.42 kDa
pI
5.08
Protein length
Gene length
function
[metabolite|spermidine], polyamine biosynthesis
product
[metabolite|arginine] decarboxylase
essential
no
ec
4.1.1.19
synonyms
speA, cad

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1982 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,534,279 → 1,535,751
Phenotypes of a mutant
no [wiki|biofilm formation] [Pubmed|24529384,20876533]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
H+ + [metabolite|L-arginine] --> [metabolite|agmatine] + CO2 (according to UniProt)
Protein family
Orn/Lys/Arg decarboxylase class-I family (together with [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]) (according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|2X3L] (from Staphylococcus aureus, 28% identity) [pubmed|20419351]
[AF|P21885]
Paralogous protein(s)
[protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]
description
[pubmed|22383849]
Open in new tab

[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]

2024-06-16 00:29:54

Jstuelk

52

ad6c8f56db9062e9c83fbac0dc85f9dfaf893a6e

CC7E9F958C18D17DDF7417E194F5FCE20FCC8311

Biological materials
Mutant
CS210 (''[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]''::''aphA3'', available in [wiki|Colin Harwood]'s and [wiki|Jörg Stülke]'s labs) [Pubmed|27197833]
BKE14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG,  downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
BKK14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG,  downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
References
24529384,19255484,9723923,20876533,27197833,20419351

03E5E41FD7ADA4E9CB70E312FA5F163331C92695

Page visits: 4201

Time of last update: 2024-06-19 15:32:39

Author of last update: Jstuelk