tkt

tkt
168

transketolase

locus
BSU_17890
Molecular weight
72.16 kDa
pI
4.8
Protein length
Gene length
function
pentose phosphate pathway
product
transketolase
essential
no
ec
2.2.1.1
synonyms
tkt, tktA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0021 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,919,861 1,921,864
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth and colony morphology [Pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate --> aldehydo-D-ribose 5-phosphate + D-xylulose 5-phosphate (according to UniProt)
Protein family
transketolase family (with [protein|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs], according to UniProt)
[wiki|Cofactors]
TPP [pubmed|35988322]
Structure
[PDB|3HYL], from B. anthracis
[AF|P45694]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]
description
[Pubmed|9068642]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]

2024-07-11 14:27:19

ghost

99

d240d8227b7d8c578e94612a78aba536e2ea480a

C39BC58B4A730B78F354000493D0F89AF615BED8

Biological materials
Mutant
BS4530 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::aphA3), available in [wiki|Jörg Stülke]'s lab
BKE17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
BKK17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
Expression vectors
pGP94 (N-terminal Strep-tag, for [wiki|SPINE], expression in B. subtilis, in [wiki|pGP380]), available in [wiki|Jörg Stülke]'s lab
for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP820, available in [wiki|Jörg Stülke]'s lab, [pubmed|20389117]
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1406 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
9924800,25267444,24929114,35988322
Original Publications
14651647,16493705,19603213,9068642,16143417,15375635,19193632,23568212,23965678,15378759

000E237B00539E6850B6A50EE01BA02844B6ACBC

Page visits: 4514

Time of last update: 2024-07-13 03:18:23

Author of last update: Jstuelk