SubtiWiki SubtiWiki
pamR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pamR
168

[wiki|MarR family|MarR/DUF24 family] transcription factor

locus
BSU_04770
Molecular weight
16.49 kDa
pI
9.36
Protein length
Gene length
function
control of the [gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|search|pamR ]operon
product
[wiki|MarR family|MarR/DUF24 family] transcription factor
essential
no
synonyms
pamR, ydcH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
525,206 → 525,649
The protein
Protein family
[wiki|MarR family|MarR/DUF24 family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 11-147) (according to UniProt)
Structure
[PDB|3BPX] ([protein|search|MarR ]from Methanothermobacter thermautotrophicus, 28% identity, aa 29 - 137) [pubmed|18272181]
Expression and Regulation
Operons
genes
[gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
description
[pubmed|29240826,22383849]
regulatory mechanism
[protein|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]: repression, [pubmed|29240826], in [regulon|protein:B7F5FA5C656D39970959BC857E93B78B1A063098|pamR regulon]
Open in new tab

[gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]→[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]

2021-11-11 08:13:27

Jstuelk

7

eb71f7532e6d3b94d6ab81a388b18c0580730f8a

368EDFBA29B4EA905E483E41BEFB00B731CFA490

genes
[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
description
[pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]→[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]

2021-11-21 19:10:34

Jstuelk

3

c5a7e7f447093e72eb642246e70fcb314785420a

DA11DAE8932F43B3BC340229664BFE8ECBB211EB

Biological materials
Mutant
MGNA-C096 (ydcH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2094 NBRP B. subtilis, Japan]
BKE04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC,  downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
BKK04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC,  downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
References
Research papers
29240826,18272181

B7F5FA5C656D39970959BC857E93B78B1A063098

Page visits: 898

Time of last update: 2021-11-19 03:57:14

Author of last update: Melvin.boenninger