SubtiWiki SubtiWiki
pamR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pamR
168

[wiki|MarR family|MarR/DUF24 family] transcription factor

locus
BSU_04770
Molecular weight
16.49 kDa
pI
9.36
Protein length
Gene length
function
control of the [gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|search|pamR ]operon
product
[wiki|MarR family|MarR/DUF24 family] transcription factor
essential
no
synonyms
pamR, ydcH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
525,206 → 525,649
The protein
Protein family
[wiki|MarR family|MarR/DUF24 family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 11-147) (according to UniProt)
Structure
[PDB|3BPX] ([protein|search|MarR ]from Methanothermobacter thermautotrophicus, 28% identity, aa 29 - 137) [pubmed|18272181]
Expression and Regulation
Operons
genes
[gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
description
[pubmed|29240826,22383849]
regulatory mechanism
[protein|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]: repression, [pubmed|29240826], in [regulon|protein:B7F5FA5C656D39970959BC857E93B78B1A063098|pamR regulon]
Open in new tab

[gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]→[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]

2020-11-06 12:56:32

Jstuelk

0

eb71f7532e6d3b94d6ab81a388b18c0580730f8a

368EDFBA29B4EA905E483E41BEFB00B731CFA490

genes
[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
description
[pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]→[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]

2021-05-18 01:33:38

Jstuelk

1

c5a7e7f447093e72eb642246e70fcb314785420a

DA11DAE8932F43B3BC340229664BFE8ECBB211EB

Biological materials
Mutant
MGNA-C096 (ydcH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2094 NBRP B. subtilis, Japan]
BKE04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC,  downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
BKK04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC,  downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
References
Research papers
29240826,18272181

B7F5FA5C656D39970959BC857E93B78B1A063098

Page visits: 870

Time of last update: 2021-08-27 20:26:40

Author of last update: Melvin.boenninger