SubtiWiki SubtiWiki
dppE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dppE
168

dipeptide [wiki|ABC transporter] (dipeptide-binding protein)

locus
BSU_12960
Molecular weight
62.41 kDa
pI
5.52
Protein length
Gene length
function
uptake of dipeptides
product
dipeptide [wiki|ABC transporter] (dipeptide-binding protein)
essential
no
synonyms
dppE, dciAE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4166

This gene is a member of the following regulons

Gene
Coordinates
1,364,151  1,365,800
The protein
Protein family
[wiki|bacterial solute-binding protein 5 family] (according to UniProt)
Structure
[PDB|4FAJ] (from Enterococcus faecalis, 33% identity) [pubmed|22948145]
Paralogous protein(s)
[protein|302DFA46D73E18C4663468ED6033C55056744475|oppA]
[wiki|Localization]
attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]) [Pubmed|10092453,18763711]
Expression and Regulation
Operons
genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
description
[Pubmed|1766371]
regulation
repressed by glucose (2.9-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|7783641], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1766371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]→[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]

2021-08-05 22:15:11

Jstuelk

3

09ee4083370400f9df0298a2b88ab5c0bbf1df43

5AB4A35A00613327500FE4CC530C2BFA97A6C07B

genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]->[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]

2021-08-16 14:15:17

Bzhu

6

9978370314fc05087eca13c4f3ce94e92ce93ff2

E2A0CC9BE866DBD9F0E3A5F48EE05465C14EFD9D

Biological materials
Mutant
GP1110 (spc), available in [wiki|Jörg Stülke]'s lab
1A737 ( ''dppE''::''kan''), [Pubmed|1766370], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A737&Search=1A737 BGSC]
BKE12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
BKK12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
References
12618455,10092453,1766371,7783641,1766371,18763711,22948145

853C570CFB9382449A20BE77B44B4FE44972AA59

Page visits: 2887

Time of last update: 2021-09-15 11:55:13

Author of last update: Melvin.boenninger