SubtiWiki SubtiWiki
dppE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dppE
168

dipeptide [wiki|ABC transporter] (dipeptide-binding protein)

locus
BSU_12960
Molecular weight
62.41 kDa
pI
5.52
Protein length
Gene length
function
uptake of dipeptides
product
dipeptide [wiki|ABC transporter] (dipeptide-binding protein)
essential
no
synonyms
dppE, dciAE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4166

This gene is a member of the following regulons

Gene
Coordinates
1,364,151  1,365,800
The protein
Protein family
[wiki|bacterial solute-binding protein 5 family] (according to UniProt)
Structure
[PDB|4FAJ] (from Enterococcus faecalis, 33% identity) [pubmed|22948145]
Paralogous protein(s)
[protein|302DFA46D73E18C4663468ED6033C55056744475|oppA]
[wiki|Localization]
attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]) [Pubmed|10092453,18763711]
Expression and Regulation
Operons
genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
description
[Pubmed|1766371]
regulation
repressed by glucose (2.9-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|7783641], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1766371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]→[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]

2021-11-20 09:07:08

Jstuelk

8

09ee4083370400f9df0298a2b88ab5c0bbf1df43

5AB4A35A00613327500FE4CC530C2BFA97A6C07B

genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]->[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]

2021-11-23 06:29:10

Bzhu

12

9978370314fc05087eca13c4f3ce94e92ce93ff2

E2A0CC9BE866DBD9F0E3A5F48EE05465C14EFD9D

Biological materials
Mutant
GP1110 (spc), available in [wiki|Jörg Stülke]'s lab
1A737 ( ''dppE''::''kan''), [Pubmed|1766370], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A737&Search=1A737 BGSC]
BKE12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
BKK12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
References
12618455,10092453,1766371,7783641,1766371,18763711,22948145

853C570CFB9382449A20BE77B44B4FE44972AA59

Page visits: 2907

Time of last update: 2021-11-25 14:42:14

Author of last update: Melvin.boenninger