ytrA

168

transcriptional repressor, GntR family, control of cell envelope stress responses in response to ramoplanin

Locus: BSU_30460

Molecular weight: 14.55 kDa

Isoelectric point: 8.09

Protein length: 130 aa

Gene length: 393 bp

Function: control of cell envelope stress responses

Product: transcriptional repressor (GntR family)

Essential: no

Synonyms: ytrA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, Newly identified competence genes

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Lifestyles, Sporulation, Sporulation/ other

Lifestyles, Coping with stress, Resistance against toxins/ antibiotics

Lifestyles, Coping with stress, Cold stress proteins

List of homologs in different organisms, belongs to COG1725 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, YtrA regulon

Gene

Coordinates: 3,118,847  3,119,239

Phenotypes of a mutant

loss of genetic competence due to overexpression of the ytrB-ytrC-ytrD-ytrE-ytrF operon PubMed
reduced sporulation efficiency PubMed
increased cell wall thickness due to overexpression of the ytrB-ytrC-ytrD-ytrE-ytrF operon PubMed

The protein

Protein family

GntR family of transcription factors

Domains

HTH gntR-type domain (aa 10-78) (according to UniProt)

Structure

3NEU (PDB) (similar protein from Listeria innocua, 41% identity)
O34712 (AlphaFold)

Paralogous protein(s)

YhcF

Expression and Regulation

Operons

Genes: ytrG-ytrA-ytrB-ytrC-ytrD-ytrE-ytrF

Description: PubMed

Regulation

expressed early in the stationary phase PubMed

Regulatory mechanism

YtrA: repression, PubMed, in ytrA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

GP2641 (ΔytrA::spc), available in Jörg Stülke's lab PubMed
GP2647 (ΔytrA::ermC), available in Jörg Stülke's lab PubMed
GP2646 Δ(ytrG-ytrA-ytrB-ytrC-ytrD-ytrE-ytrF)::ermC, available in Jörg Stülke's lab PubMed
MGNA-A138 (ytrA::erm), available at the NBRP B. subtilis, Japan
BKE30460 (ytrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTACTTCCCTACTTTCT,  downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
BKK30460 (ytrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTACTTCCCTACTTTCT,  downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA

References

Loading