ylmD

ylmD
168

peptidoglycan-editing factor, prevents incorporation of glycine or L-serine into the PG sacculi

locus
BSU_15370
Molecular weight
30.79 kDa
pI
6.18
Protein length
Gene length
function
quality control to maintain composition and integrity of peptidoglycan
product
peptidoglycan-editing factor
essential
no
synonyms
ylmD, pgeF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1496 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,609,327 → 1,610,163
Phenotypes of a mutant
sensitive to ß-lactam antibiotics [pubmed|28612943]
The protein
Protein family
multicopper oxidase YfiH/RL5 family (single member, according to UniProt)
Structure
[PDB|1T8H] (from Geobacillus stearothermophilus, 52% identity)
[AF|O31726]
Expression and Regulation
Operons
genes
[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]-[gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]-[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]-[gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]-[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]
description
[Pubmed|16420366]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]→[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]

2025-10-27 13:18:10

ghost

167

d444960f93629c61035f6c91fd3ada83c687ea2d

12299F7737A00124F5303235F9BC3A294A212ACF

Biological materials
Mutant
MGNA-B125 (ylmD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1124 NBRP B. subtilis, Japan]
BKE15370 (Δ[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATCCAACCTTTCG,  downstream forward: _UP4_GGAATGAAGGAGGCATAAAA
BKK15370 (Δ[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATCCAACCTTTCG,  downstream forward: _UP4_GGAATGAAGGAGGCATAAAA
References
14651647,16420366,28612943,32900832

ECCE99438DBFC52DA7236CB4F6486DD004CADF73

Page visits: 5057

Time of last update: 2025-10-28 10:21:05

Author of last update: Jstuelk