mdfA

168

metabolic differentiation factor A, sporulation-specific adaptor protein, targets proteins to degradation by ClpC-ClpP during sporulation

Locus: BSU_11410

Molecular weight: 29.97 kDa

Isoelectric point: 5.15

Protein length: 250 aa

Gene length: 753 bp

Function: control of ClpC-ClpP-mediated degradation of metabolic enzymes in the forespore

Product: metabolic differentiation factor A, adaptor protein

Essential: no

E.C.: null

Synonyms: yjbA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5917 (Galperin et al., 2021)

Gene

Coordinates: 1,217,326  1,218,078

Phenotypes of a mutant

• mutant: increased SigF-dependent gene expression during early sporulation PubMed
• mutant: reduced sporulation (20 ... 30% of wild type) PubMed
• overexpression of MdfA: toxic during vegetative growth, this can be suppressed by inactivation of clpC PubMed
• reduced spore resistance to oxidative stress

The protein

Catalyzed reaction/ biological activity

• targets CitZ for ClpC-ClpP-dependent degradation in the forespore PubMed

Protein family

• UPF0736 family (single member, according to UniProt)

Domains

• N-terminal domain: aa 1 ... 135 PubMed
• C-terminal domain: aa 143 ... 250 PubMed

Structure

• 8B3S (PDB) (the MdfA-ClpC complex) PubMed
• O31597 (AlphaFold)

Localization

• peripheral forespore membrane protein PubMed
• forespore cytoplasm PubMed

Expression and Regulation

Operons

• Genes: mdfA

  Description: PubMed

  Regulation

  • expressed from 2 hrs after onset of sporulation (SigF) bioRxiv

  Sigma factors

  • SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

• MGNA-B149 (yjbA::erm), available at the NBRP B. subtilis, Japan
• BKE11410 (mdfA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCTAACCCCTCACTTT,  downstream forward: _UP4_TGAAAAAAACCGCTCTTTGC
• BKK11410 (mdfA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCTAACCCCTCACTTT,  downstream forward: _UP4_TGAAAAAAACCGCTCTTTGC

References

Loading