rho

168

transcriptional termination protein, prevents the formation of antiterminator-like RNA structures that could otherwise compete with the terminator hairpin, involved in balanced regulation of cell motility, Biofilm formation, and Sporulation

Locus: BSU_37080

Molecular weight: 48.51 kDa

Isoelectric point: 6.86

Protein length: 427 aa

Gene length: 1284 bp

Function: transcriptional termination

Product: transcriptional termination protein

Essential: no

Synonyms: rho

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1158 (Galperin et al., 2021)

Gene

Coordinates: 3,803,400  3,804,683

Phenotypes of a mutant

• loss of motility due to poor expression of the SigD regulon, this can be partially reversed by inactivation of slrR PubMed
• no Biofilm formation, this can be suppressed by deletion of sinR and by switching of expression of the epsO-epsA antisense transcript PubMed
• increased efficiency of Sporulation, due to enhanced Spo0A phosphorylation PubMed
• defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

• prevents the formation of antiterminator-like RNA structures that could otherwise compete with the terminator hairpin PubMed

Protein family

• Rho family (single member, according to UniProt)

Domains

• CSD domain (aa 54-127) (according to the InterPro database)
• Rho RNA-BD domain (aa 51-125) (according to UniProt)

Structure

• 1PVO (PDB) (Rho from E. coli) PubMed
• 8HSR (PDB) (Rho-RNA polymerase termination complex from Thermus thermophilus) PubMed
• Q03222 (AlphaFold)

Expression and Regulation

Operons

• Genes: spo0F-fbaA-ywjH-murAB-glpX-rho-rpmE

  Description: PubMed

  Expression

  • readthrough-transcription from the SigH-dependent promoter after the initiation of sporulation in the mother cell PubMed

• Genes: rho-rpmE

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, during vegetative growth PubMed, in sigA regulon
  • SigF: sigma factor, after initiation of sporulation in the forespore PubMed, in sigF regulon

Biological materials

Mutant

• GP2673 (rho::ermC), available in Jörg Stülke's lab
• BKE37080 (rho::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAACACCACGCTTTT,  downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
• BKK37080 (rho::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAACACCACGCTTTT,  downstream forward: _UP4_TAAATTGTATTTGCAAAAGA

References

Reviews

Loading

Original Publications

Loading