recX

168

recombination protein, modulates the SOS response and facilitates RecA-mediated recombinational repair and genetic recombination, crucial for the RecA-dependent acquisition of homologous genes from related species by natural transformation

Locus: BSU_08520

Molecular weight: 30.86 kDa

Isoelectric point: 6.29

Protein length: 264 aa

Gene length: 795 bp

Function: DNA repair/ recombination

Product: recombination protein

Essential: no

Synonyms: recX, yfhG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2137 (Galperin et al., 2021)

Gene

Coordinates: 925,633  926,427

Phenotypes of a mutant

• reduced natural transformation with plasmid or chromosomal DNA PubMed
• drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed

The protein

Catalyzed reaction/ biological activity

• modulates the "length or packing" of a RecA filament, thereby RecX facilitates the initiation of recombination and increases recombination across species PubMed
• inhibits RecA-catalyzed ATP hydrolysis PubMed
• inhibits stable RecA nucleation and polymerization on ssDNA PubMed
• induces RecA nucleoprotein filament depolymerization PubMed
• promotes a net RecA disassembly from viral ssDNAs not homologous to the host genome PubMed

Protein family

• recX family (single member, according to UniProt)

Structure

• 3D5L (PDB) (from Lactobacillus reuterii, 36% identity)
• O31575 (AlphaFold)

Localization

• forms foci on the nucleoid upon DNA damage PubMed
• forms foci at the cells poles and/ or the nucleoid upon induction of genetic competence PubMed

Expression and Regulation

Operons

• Genes: recX-yfhH

  Description: PubMed

Biological materials

Mutant

• GP3533 (ΔrecX::kan), available in Jörg Stülke's lab
• MGNA-C361 (yfhG::erm), available at the NBRP B. subtilis, Japan
• BKE08520 (recX::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA,  downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
• BKK08520 (recX::kan  trpC2) available at BGSC and in Jörg Stülke's lab,  PubMed, upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA,  downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA

References

Loading