yydB
168
unknown
locus
BSU_40220
Molecular weight
56.29 kDa
pI
4.99
function
unknown
product
unknown
essential
no
synonyms
yydB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1409 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
4,132,729 → 4,134,174
The protein
Protein family
[wiki|Metallophosphoesterase superfamily] (according to UniProt)
Structure
[AF|Q45600]
Expression and Regulation
Operons
genes
[gene|660FD9F2AC911E4E70E242F14A2EA6A208F25E28|yyzF]-[gene|AC2A9DC3DA569231442582A95EDB2A98BA335184|rlmH]-[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]-[gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]-[gene|1470E1E1BAE5EA5BA9831E2BCEF9B61E79450510|yydD]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-B813 (yydB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1812 NBRP B. subtilis, Japan]
BKE40220 (Δ[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAAACATCCTCTCAT, downstream forward: _UP4_AAGAATGATTGATCTTAAAA
BKK40220 (Δ[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAAACATCCTCTCAT, downstream forward: _UP4_AAGAATGATTGATCTTAAAA
Page visits: 3233
Time of last update: 2025-10-24 08:12:06
Author of last update: Jstuelk