pchR

168

transcriptional repressor (MarR family), controls the expression of genes involved in pulcherriminic acid biosynthesis

Locus: BSU_35080

Molecular weight: 19.54 kDa

Isoelectric point: 8.09

Protein length: 169 aa

Gene length: 510 bp

Function: control of pulcherriminic acid biosynthesis

Product: transcription factor (MarR family)

Essential: no

Synonyms: pchR, yzhA, yvmB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Homeostasis, Acquisition of iron, Acquisition of iron / Other

List of homologs in different organisms, belongs to COG1846 (Galperin et al., 2021)

This gene is a member of the following regulons

CcpA regulon, PchR regulon

Gene

Coordinates: 3,604,993  3,605,502

Phenotypes of a mutant

the mutant tends to acquire suppressor mutations that result in improved growth PubMed
inactivation of ''pchR'' causes widespread disruption of proteins involved in cellular processes that depend on iron availability, with pleiotropic effects on proteins associated with carbon metabolism, translation, stress response, biosynthesis of cell wall, and sporulation initiation PubMed

The protein

Protein family

MarR family of transcriptional regulators PubMed

Domains

HTH marR-type domain (aa 10-153) (according to UniProt)

Structure

P40762 (AlphaFold)

Paralogous protein(s)

YhjH

Additional information

Proposed consensus sequence for DNA-binding site: GTTYMMYMGTAAAC PubMed

Expression and Regulation

Operons

Genes: pchR-yvmA

Description: PubMed

Regulation

induced by iron starvation PubMed

Regulatory mechanism

CcpA: repression, PubMed; PchR auto-repression PubMed, in ccpA regulon
PchR: repression, in pchR regulon

Biological materials

Mutant

CS217 (''pchR::aphA3'', available in Colin Harwood's and Jörg Stülke's lab PubMed
BKE35080 (pchR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT,  downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
BKK35080 (pchR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT,  downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC

Labs working on this gene/protein

Sandrine Auger, Micalis Institute, INRA, AgroParisTech, France

References

Loading