yqgS

yqgS
168

polyglycerolphosphate lipoteichoic acid synthase

locus
BSU_24840
Molecular weight
73.03 kDa
pI
4.82
Protein length
Gene length
function
biosynthesis of lipoteichoic acid
product
minor lipoteichoic acid synthase
essential
no
synonyms
yqgS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1368 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,568,573  2,570,489
The protein
Protein family
[wiki|LTA synthase family] (according to UniProt)
Structure
[PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS] from S. aureus, corresponds to aa 218 ... 617 of [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]) [pubmed|19168632]
[AF|P54496]
Modification
can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] in vitro [pubmed|30478337]
Paralogous protein(s)
[protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]
[wiki|Localization]
localizes to the division septum [Pubmed|19229300]
Expression and Regulation
Operons
genes
[gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
description
[pubmed|22383849]
additional information
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
Open in new tab

[gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]→[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]

2025-10-29 00:49:02

Jstuelk

164

a1ca89060787c1fe2f14ef34abd6ea4555e517f1

27E8D0EE2E860F577FC79AA0ADCE162D21DD5DD4

Biological materials
Mutant
MGNA-C419 (yqgS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2417 NBRP B. subtilis, Japan]
BKE24840 ([gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG,  downstream forward: _UP4_TAATCACAATGTCTCCCGCA
BKK24840 ([gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG,  downstream forward: _UP4_TAATCACAATGTCTCCCGCA
References
Reviews
21388439,21255102
Original Publications
19229300,21255105,23103977,19168632,30478337

2B33F2F9C2FB0767B72A29D060037393C88ACEE5

Page visits: 3457

Time of last update: 2025-10-28 21:53:09

Author of last update: TPed