yqbA

168

similar to phage-related protein

Locus: BSU_26180

Molecular weight: 58.29 kDa

Isoelectric point: 4.95

Protein length: 510 aa

Gene length: 1533 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yqbA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5518 (Galperin et al., 2021)

Gene

Coordinates: 2,686,770  2,688,302

The protein

Protein family

• phage portal family (with XkdE, according to UniProt)

Structure

• P45917 (AlphaFold)

Expression and Regulation

Additional information

• translation is likely to require Efp due to the presence of several consecutive proline residues PubMed

Biological materials

Mutant

• BKE26180 (yqbA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTAACAGATTTTTTTGACA,  downstream forward: _UP4_GATGTTCTGGAGGATTTGAA
• BKK26180 (yqbA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTAACAGATTTTTTTGACA,  downstream forward: _UP4_GATGTTCTGGAGGATTTGAA