ypbH

ypbH
168

putative adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]

locus
BSU_22970
Molecular weight
22.01 kDa
pI
4.09
Protein length
Gene length
function
unknown
product
putative adaptor protein
essential
no
synonyms
ypbH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4862 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,403,506 → 2,404,090
Phenotypes of a mutant
deletion reduces sporulation to 20%, overexpression abolishes sporulation [Pubmed|11914365]
The protein
Protein family
mecA family (with [protein|331993A875907C10C77105FD8DDD86D4412CE405|mecA], according to UniProt)
Structure
[PDB|3JTO] (C-terminal domain) [Pubmed|19801546]
[AF|P50734]
Paralogous protein(s)
[protein|331993A875907C10C77105FD8DDD86D4412CE405|mecA]
Expression and Regulation
Operons
genes
[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]
description
[Pubmed|22383849]
Open in new tab

[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]

2025-10-22 16:10:08

Jstuelk

88

d9faeea645b9bf260ec94a66dbedbf2368cb70c4

FE08949AE24089035244D34EF0D6F66F0EA817FD

Biological materials
Mutant
MGNA-A415 (ypbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/415 NBRP B. subtilis, Japan]
GP812 (spc), GP814 (spc) both available in the [wiki|Stülke] lab
BKE22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT,  downstream forward: _UP4_TAAGAATGCAACGGAAAACT
BKK22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT,  downstream forward: _UP4_TAAGAATGCAACGGAAAACT
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
19609260,23375660
Original Publications
11914365,19801546

CE1C46944E242006383BA77B2C4E09045CB3B93F

Page visits: 3622

Time of last update: 2025-10-28 13:03:15

Author of last update: Melvin.boenninger