yoaD

168

similar to phosphoglycerate dehydrogenase

Locus: BSU_18560

Molecular weight: 38.47 kDa

Isoelectric point: 5.62

Protein length: 344 aa

Gene length: 1035 bp

Function: methionine biosynthesis

Product: unknown

Essential: no

Synonyms: yoaD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0111 (Galperin et al., 2021)

Gene

Coordinates: 2,024,042  2,025,076

The protein

Catalyzed reaction/ biological activity

• YoaD is likely to convert 3-phosphoglycerate to serine for use in methionine biosynthesis (based on S-box regulation)

Protein family

• D-isomer specific 2-hydroxyacid dehydrogenase family (with YvcT and SerA, according to UniProt)

Structure

• 1WWK (PDB) (phosphoglycerate dehydrogenase from Pyrococcus horikoshii, 35% identity)
• O34815 (AlphaFold)

Additional information

• The gene is annotated in KEGG as an ortholog of D-3-phosphoglycerate dehydrogenase EC 1.1.1.95. No EC annotation is available in Swiss-Prot. In MetaCyc the protein is marked as similar to phosphorglycerate dehydrogenase. No literature/experimental evidence supporting the annotation is available.  PubMed

Expression and Regulation

Operons

• Genes: yoaD-yoaC-yoaB

  Description: PubMed

  Regulation

  • induced by methionine starvation (S-box) PubMed
  • the S-box RNA is degraded by RNase Y PubMed

  Regulatory mechanism

  • S-box: RNA switch, , the S-box riboswitch binds S-adenosylmethionine resulting in termination PubMed, in S-box

Biological materials

Mutant

• MGNA-A835 (yoaD::erm), available at the NBRP B. subtilis, Japan
• BKE18560 (yoaD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC,  downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
• BKK18560 (yoaD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC,  downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA

References

Loading