sirB

168

sirohydrochlorin ferrochelatase

Locus: BSU_15620

Molecular weight: 28.69 kDa

Isoelectric point: 6.06

Protein length: 261 aa

Gene length: 786 bp

Function: siroheme biosynthesis, sulfite reduction

Product: sirohydrochlorin ferrochelatase

Essential: no

Synonyms: sirB, ylnE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2138 (Galperin et al., 2021)

Gene

Coordinates: 1,634,837  1,635,622

The protein

Catalyzed reaction/ biological activity

• insertion of Fe2+ into the substrate sirohydrochlorin (SHC) in siroheme biosynthesis PubMed
• 2 H⁺ + siroheme --> Fe²⁺ + sirohydrochlorin (according to UniProt)

Protein family

• CbiX family (single member, according to UniProt)

Structure

• Apo-form: 5ZT8 (PDB) PubMed
• Co²⁺ bound: 5ZT7 (PDB) (PubMed), 6JV6 (PDB)
• Ni²⁺ bound: 5ZT9 (PDB)
• Fe³⁺ bound: 5ZTA (PDB)
• O34632 (AlphaFold)

Expression and Regulation

Operons

• Genes: cysH-cysP-sat-cysC-ylnD-sirB-ylnF

  Description: PubMed

  Regulation

  • induced by methionine starvation (S-box) PubMed
  • the S-box RNA is degraded by RNase Y PubMed

  Regulatory mechanism

  • CymR: transcription repression, [pubmed|], in cymR regulon
  • S-box: RNA switch, , the S-box riboswitch binds S-adenosylmethionine resulting in termination PubMed, in S-box

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-B369 (ylnE::erm), available at the NBRP B. subtilis, Japan
• BKE15620 (sirB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA,  downstream forward: _UP4_CAATTTGATTTTGATGGAGG
• BKK15620 (sirB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA,  downstream forward: _UP4_CAATTTGATTTTGATGGAGG

References

Loading