tmcAL

168

tRNA^Met cytidine acetate ligase, required for proper decoding of the AUA elongator Met codon

Locus: BSU_15060

Molecular weight: 46.83 kDa

Isoelectric point: 7.8

Protein length: 415 aa

Gene length: 1248 bp

Function: acetylation of elongator tRNA^Met

Product: tRNA^Met cytidine acetate ligase

Essential: no

Synonyms: tmcAL, ylbM

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1323 (Galperin et al., 2021)

Gene

Coordinates: 1,573,807  1,575,054

Phenotypes of a mutant

• cold-sensitive PubMed
• restores viability of a ''smc'' mutant on rich medium due to the induction of a stringent response PubMed
• defective in swarming motility (reduced rate of colony expansion) PubMed

The protein

Catalyzed reaction/ biological activity

• acetylation of the first position of the anticodon (position 34) of elongator tRNA^Met PubMed
• acetate + ATP + cytidine³⁴ in elongator tRNA^Met --> AMP + diphosphate + N⁴-acetylcytidine³⁴ in elongator tRNA^Met (according to UniProt)

Protein family

• TmcAL family (single member, according to UniProt)

Structure

• 5Y0O (PDB) (apo-form) PubMed
• 5Y0P (PDB) (bound to alpha-thio ATP) PubMed
• 5Y0Q (PDB) (bound to AMPCPP) PubMed
• 5Y0N (PDB) (selenomethionine derivative) PubMed
• O34513 (AlphaFold)

Expression and Regulation

Operons

• Genes: ylzH-tmcAL

  Description: PubMed

Biological materials

Mutant

• MGNA-B250 (ylbM::erm), available at the NBRP B. subtilis, Japan
• BKE15060 (tmcAL::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTCAACCACCAATCCGACAG,  downstream forward: _UP4_AATGTATAGAAAAAGCACCT
• BKK15060 (tmcAL::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTCAACCACCAATCCGACAG,  downstream forward: _UP4_AATGTATAGAAAAAGCACCT

References

Loading