yjcF
168
similar to GCN5-related N-acetyltransferase
locus
BSU_11840
Molecular weight
15.53 kDa
pI
5.53
function
unknown
product
unknown
essential
no
synonyms
yjcF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG2153 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,256,436 1,256,858
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 2-140) (according to UniProt)
Structure
[PDB|1Q2Y]
[AF|O31628]
Paralogous protein(s)
[protein|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT], [protein|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|yybD]
Expression and Regulation
Operons
genes
[gene|94EE92D99CA68856E6D19254B0768FFE92AF603D|yjcH]-[gene|5CA17CD28A725B8D7B87B9AAA167844042439794|yjcG]-[gene|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|yjcF]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-B297 (yjcF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1296 NBRP B. subtilis, Japan]
BKE11840 ([gene|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|yjcF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCGATAACTGCTTTCA, downstream forward: _UP4_TGAACGCATCCGGATCTTTT
BKK11840 ([gene|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|yjcF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCGATAACTGCTTTCA, downstream forward: _UP4_TGAACGCATCCGGATCTTTT
References
Reviews
Original Publications
Page visits: 2834
Time of last update: 2025-10-27 18:09:39
Author of last update: Jstuelk