yisJ
168
unknown
locus
BSU_10740
Molecular weight
35.53 kDa
pI
8.05
function
unknown
product
unknown
essential
no
synonyms
yisJ
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG5337 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,151,166 1,152,089
The protein
Protein family
cotH family (with [protein|D53067098F693669F61E5CCF6C06664580C40C79|cotH], according to UniProt)
Structure
[PDB|5JD9] (from B. cereus, 28% identity)
[AF|O06723]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]-[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
description
[Pubmed|22383849]
regulation
induced during [wiki|sporulation] [Pubmed|22383849]
strongly expressed during oligotrophic growth [pubmed|30792386]
Biological materials
Mutant
MGNA-B189 (yisJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1188 NBRP B. subtilis, Japan]
BKE10740 ([gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTTTCCTCCTTCTC, downstream forward: _UP4_TAGTCCTTTCTCCATTAAAA
BKK10740 ([gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTTTCCTCCTTCTC, downstream forward: _UP4_TAGTCCTTTCTCCATTAAAA
References
Research papers
Page visits: 3383
Time of last update: 2025-10-28 17:29:02
Author of last update: Melvin.boenninger