yfjM
168
binds to DNA lesions, may be involved in DNA repair
locus
BSU_08040
Molecular weight
17.02 kDa
pI
6.41
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfjM
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
877,599 → 878,051
The protein
Catalyzed reaction/ biological activity
binds to abasic and RNA base DNA lesions [pubmed|37250769]
Structure
[AF|O31547]
Expression and Regulation
Operons
genes
[gene|AF019A5EBB9A09326D3D19EB3AFB6D0B808950D2|yfjM]-[gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]
description
[pubmed|22383849]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
Biological materials
Mutant
MGNA-C278 (yfjM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2276 NBRP B. subtilis, Japan]
BKE08040 (Δ[gene|AF019A5EBB9A09326D3D19EB3AFB6D0B808950D2|yfjM]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCTCCCCCTTTA, downstream forward: _UP4_TAGCACGTACATATGAGGAA
BKK08040 (Δ[gene|AF019A5EBB9A09326D3D19EB3AFB6D0B808950D2|yfjM]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCTCCCCCTTTA, downstream forward: _UP4_TAGCACGTACATATGAGGAA
References
Page visits: 2176
Time of last update: 2025-10-24 06:27:56
Author of last update: Jstuelk