aimB

168

amino acid permease, minor threonine and serine transporter

Locus: BSU_02060

Molecular weight: 49.94 kDa

Isoelectric point: 9.6

Protein length: 462 aa

Gene length: 1389 bp

Function: uptake of threonine and serine

Product: amino acid permease

Essential: no

Synonyms: ybxG, ybdP

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1113 (Galperin et al., 2021)

Gene

Coordinates: 226,566  227,954

Phenotypes of a mutant

• a bcaP aimB mutant confers resistance to 4-hydroxythreonine PubMed

The protein

Catalyzed reaction/ biological activity

• uptake of threonine and serine PubMed, (symport with H⁺)
• uptake of diaminopropionic acid PubMed, (symport with H⁺)

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• 5OQT (PDB) (from Geobacillus kaustophilus, 23% identity) PubMed
• P54425 (AlphaFold)

Paralogous protein(s)

• RocC, RocE, YbgF, YdgF, AapA, GabP, AlaP, HutM, YvbW

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: aimB

  Description: PubMed

Biological materials

Mutant

• GP2396 ∆''aimB ::cat'' available in Jörg Stülke's lab PubMed
• BKE02060 (''aimB::erm''), available in the BGSC and in Fabian Commichau's and Jörg Stülke's labs) PubMed
• BKE02060 (aimB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA,  downstream forward: _UP4_TAACGATAAAAAAGAGACAT
• BKK02060 (aimB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA,  downstream forward: _UP4_TAACGATAAAAAAGAGACAT

References

Loading