murR

168

transcriptional repressor of genes required for the utilization of N-acetylmuramic acid

Locus: BSU_01690

Molecular weight: 30.56 kDa

Isoelectric point: 6.87

Protein length: 283 aa

Gene length: 852 bp

Function: regulation of muramic acid utilization

Product: transcriptional repressor

Essential: no

Synonyms: murR, ybbH

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall degradation/ turnover, Utilization of cell wall components

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of amino sugars

Metabolism, Amino acid/ nitrogen metabolism, Utilization of nitrogen sources other than amino acids, Utilization of amino sugars

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

List of homologs in different organisms, belongs to COG1737 (Galperin et al., 2021)

This gene is a member of the following regulons

MurR regulon

Gene

Coordinates: 191,183  192,034

The protein

Domains

HTH rpiR-type domain (aa 3-79) (according to UniProt)
SIS domain (aa 123-264) (according to UniProt)

Structure

2O3F (PDB) (N-terminal domain)
8JU9 (PDB) (from Pseudomonas aerugingsa, 30.7% identity) PubMed
Q45581 (AlphaFold)

Expression and Regulation

Operons

Genes: murQ-murR-murP-amiE-nagZ-namZ

Description: PubMed

Regulation

expressed in late exponential and early stationary phase PubMed

Regulatory mechanism

MurR: repression, PubMed, in murR regulon

Biological materials

Mutant

MGNA-B951 (ybbH::erm), available at the NBRP B. subtilis, Japan
BKE01690 (murR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGTGGCCATTCTAGTTCTCT,  downstream forward: _UP4_TAAGGCATCTTGAAGGGGAG
BKK01690 (murR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGTGGCCATTCTAGTTCTCT,  downstream forward: _UP4_TAAGGCATCTTGAAGGGGAG

References

Loading